Article No
BT-1IZSQS-500
Specifications
| MW | ~44kDa |
| Article No | BT-1IZSQS-500 |
| Biosite Brand | Biosite |
| Country Availability | all |
| Description | CD112/NECTIN2 |
| Supplier | Nordic Biosite |
| Notes | Nectin-2, also known as CD112 and poliovirus receptor-related 2 (PVRL2), is a single-pass type I membrane glycoprotein ubiquitously expressed on various human tissues. It is a calcium independent cell adhesion molecule known to interact with several cell surface receptors, including DNAM-1 (CD226), LFA-1 (CD11a), Nectin-3 (CD113), TIGIT (VSTM3), and PVRIG (CD112R). It is one of the major constituents of adherens junctions, and therefore plays a central role in a number of cellular processes, including adhesion, migration, and proliferation. Within the immune system, Nectin-2 modulates immune cell signaling. Upon interaction with DNAM-1 expressed on T and NK cells, Nectin-2 stimulates proliferation and cytokine production. Upon interaction with PVRIG, Nectin-2 inhibits proliferation. Thus, Nectin-2 can be either a co-stimulator or a co-inhibitor of immune cell function depending on competitive receptor interactions. Nectin-2 also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. |
| Product Type | Proteins & Peptides |
| Purification | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
| Purity | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
| Sequence | CAGGATGTTCGCGTGCAGGTGCTGCCGGAAGTGCGCGGTCAGCTGGGTGGCACCGTGGAACTGCCGTGCCATCTGCTGCCGCCGGTGCCTGGTCTGTATATTAGTCTGGTTACCTGGCAGCGTCCGGATGCACCGGCAAATCATCAGAATGTTGCCGCCTTCCATCCGAAAATGGGCCCGAGCTTCCCGAGTCCGAAACCGGGCAGTGAACGTCTGAGCTTCGTTAGTGCAAAACAGAGCACCGGCCAGGATACCGAAGCCGAACTGCAGGATGCCACCCTGGCACTGCATGGTCTGACCGTGGAAGATGAAGGCAATTATACCTGTGAATTCGCAACCTTCCCGAAAGGTAGTGTTCGTGGTATGACCTGGCTGCGCGTGATTGCAAAACCGAAAAATCAGGCAGAAGCACAGAAAGTGACCTTCAGTCAGGATCCGACCACCGTGGCACTGTGCATTAGTAAAGAAGGTCGTCCGCCGGCACGCATTAGTTGGCTGAGCAGCCTGGATTGGGAAGCCAAAGAAACACAAGTGAGCGGTACCCTGGCCGGTACCGTTACCGTGACCAGTCGCTTCACCCTGGTGCCGAGCGGCCGCGCAGATGGTGTGACCGTTACCTGTAAAGTTGAACATGAAAGCTTCGAAGAACCGGCACTGATTCCGGTTACCCTGAGTGTTCGTTATCCGCCGGAAGTTAGTATTAGTGGCTATGATGATAATTGGTATCTGGGCCGCACCGATGCCACCTTAAGTTGTGATGTGCGCAGTAATCCGGAACCGACCGGTTATGATTGGAGCACCACCAGTGGCACCTTCCCGACCAGCGCCGTTGCCCAGGGCAGCCAACTGGTGATTCATGCCGTGGATAGTCTGTTCAATACCACCTTCGTGTGCACCGTGACCAATGCAGTTGGTATGGGTCGTGCAGAACAGGTGATCTTCGTTCGCGAAACACCTAATACCGCAGGTGCCGGTGCCACCGGTGGT |
| Size | 500ug |
| Source / Host | bacteria |
| Storage | Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles. |
| Substrate / Buffer | PBS, 4M Urea, PH7.4 |
| Swiss-Prot No | Q92692 |
| Product Page Updated | 2024-01-04T12:20:49.260Z |