Article No
BT-IBHH90-1
Specifications
| MW | ~30kDa |
| Article No | BT-IBHH90-1 |
| Biosite Brand | Biosite |
| Country Availability | all |
| Description | CD129/IL9R |
| Supplier | Nordic Biosite |
| Notes | Interleukin-9 (IL-9) functions to support the growth of helper T cells, megakaryoblastic leukemia cells, fetal thymocytes, erythroid and myeloid precursors and mast cells. The murine IL-9 receptor has been identified as a protein expressed on a T cell clone. Both the murine and human IL-9 receptor cDNAs have been isolated by expression cloning from the murine T cell clone TS1 and the human megakaryoblastic leukemia cell line MO7E, respectively. In addition, the cloning and analysis of the complete human IL-9 receptor genomic DNA has been reported. In this latter study, the IL-9R gene was shown to consist of 10 exons expressed over approximately 13.7 kb of DNA. |
| Product Type | Proteins & Peptides |
| Purification | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
| Purity | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
| Sequence | AGTGTGACCGGTGAAGGTCAGGGTCCGCGTAGCCGTACCTTCACCTGTCTGACCAATAATATTCTGCGCATTGATTGCCATTGGAGCGCCCCGGAACTGGGTCAGGGTAGCAGTCCGTGGCTGCTGTTCACCAGCAATCAGGCCCCGGGTGGTACCCATAAATGCATTCTGCGTGGCAGCGAATGCACCGTTGTGCTGCCGCCGGAAGCCGTGCTGGTTCCGAGTGATAACTTCACCATTACCTTCCATCATTGCATGAGTGGTCGTGAACAGGTTAGTCTGGTTGATCCGGAATATCTGCCGCGTCGTCATGTTAAACTGGATCCGCCGAGTGATCTGCAGAGCAATATTAGTAGCGGCCATTGCATTCTGACCTGGAGCATTAGCCCGGCCCTGGAACCGATGACCACCCTGCTGAGTTATGAACTGGCCTTCAAAAAACAGGAAGAAGCCTGGGAACAGGCACAGCATCGTGATCATATTGTTGGTGTGACCTGGCTGATTCTGGAAGCCTTCGAACTGGATCCGGGCTTCATTCATGAAGCCCGTCTGCGCGTTCAGATGGCAACCCTGGAAGATGATGTTGTGGAAGAAGAACGTTATACCGGCCAGTGGAGTGAATGGAGCCAGCCGGTGTGCTTCCAGGCACCGCAGCGTCAGGGCCCGCTGATTCCGCCTTGGGGTTGGCCG |
| Size | 1mg |
| Source / Host | bacteria |
| Storage | Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles. |
| Substrate / Buffer | PBS, 4M Urea, PH7.4 |
| Swiss-Prot No | Q01113 |
| Product Page Updated | 2024-01-04T12:20:49.260Z |