TotalSeq™ Antibody Oligonucleotide Conjugates Reagents

- for High-Throughput Single Cell Proteogenomics

Antibody-oligonucleotide conjugates are required in a number of expanding applications, particularly in single cell multiomics where extensive data sets can be generated at the molecular level from a single cell. Cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) combines scRNA-Seq and Proteomics in one application, to quantify RNA and protein at the same time. This page explores the capabilities of custom antibody-oligo conjugations, and their applications.

TotalSeq™ Barcodes

Sequences were designed to work with Illumina sequencers and the 10X Genomics platform but should work in any other droplet-based cell-isolation system. The full name of the product includes the associated platform, the barcode identifier, and the target molecule. For example, a conjugated antibody against human CD80 would be named TotalSeq™-A0005 anti-human CD80. Barcodes are clone-specific. The full sequence of the oligonucleotide includes a PCR handle (CCTTGGCACCCGAGAATTCCA), the 15 bp barcode in the table below, and a poly A tail (BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A).

The oligonucleotide sequence for a readily available anti-mouse CD4 conjugate, clone RM4-5, is CCTTGGCACCCGAGAATTCCAAACAAGACCCTTGAGBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A. The name of this product is TotalSeq™-A0001 anti-mouse CD4.

 

 CITE-seq workflow and data

  1. Stain with TotalSeq™ reagents
  2. Run single cell platform, with Antibody- Derived Tags (ADT, antibody-oligo conjugates) amplification
  3. Separate ADT-derived cDNA from mRNA-derived cDNA
  4. Amplify both cDNA libraries
  5. Sequence libraries
Fig 1. Diagram illustrating CITE-seq workflow. Step 2 can be performed by Drop-seq (depicted in the figure), or another compatible method such as 10X Genomics platform.
Fig 2. Clustering of approximately 5,000 CITE-seq single-cell expression profiles of PBMCs reveals distinct cell populations based on transcriptome analysis. The left panel shows a two-dimensional representation (tSNE) of global gene expression relationships among all cells. Major cell types in peripheral blood can be discerned based on marker gene expression as indicated. The right panels show mRNA (blue) and corresponding Antibody-Derived Tag (ADT, green) signal for the CITE-seq antibody panel projected on the tSNE plot. Darker shading corresponds to higher levels measured.

 

Cell Hashing

In addition to the collection of antibody oligonucleotide conjugates for protein quantification, the process of identifying each cell with its sample origin is also being refined, as well as data generated from doublets instead of single cells when mixing multiple samples. The method is powered by the cell hashtag reagents. Please read Stoeckius M. et al. for more information about cell hashing.

The hashtags are designed so that they are specific for human or mouse cells, and to cover as many cells as possible. For human samples the hashtags are made of two antibodies that recognize ubiquitous surface markers, CD298 and β2 microglobulin, each conjugated to the same oligonucleotide containing the barcode sequence. For mouse samples, the surface markers are CD45 and H-2 MHC class I. The conjugates are already pre-mixed and ready to use.

The full sequence of the oligonucleotide includes a PCR handle (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), the 15 bp barcode in the table below, and a poly A tail (BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A). The hashtag's name includes a sequential numeral identifier (different from the barcode number) for convenience when designing multiplex experiments.

 

See all TotalSeq™